Homo sapiens (human) small nucleolar RNA, H/ACA box 23 (SNORA23)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, H/ACA box 23 (SNORA23) URS0000064325_9606

189 nucleotides
2 databases (ENA, GeneCards)
Found in 0 other species
71 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA23: SNORA23 is an H/ACA box snoRNA that is similar to other known snoRNAs like TERC [PMC9394076]. TERC is an independently transcribed sequence that is not part of any known cellular mRNA [PMC9394076]. The migration and invasion abilities of HCC cell lines overexpressing SNORA23 and SNORA73B were assessed using Transwell and wound healing migration assays [PMC8763008]. In pancreatic ductal adenocarcinoma, downregulation of SNORA23 expression using antisense oligonucleotide (ASO) reduced tumor growth, dissemination, and liver metastasis [PMC6629867].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CAUGGCUGCUGUAAUGUGUGCAUAGGUUUCAUCUGUGUCUGGUAGCAGUGUCUGUCUGUGUUUUGCAUUCAGAUCUUGCUAUCCACACAAACAUCAUGCGGCCAAAGAGUAACUUGGGAUCAUAGUACUGGUCUAGUGUUGUCUCUGGACACAUCUACCACUGGCCAGCCUCCAAAUUCCCACACACAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure

Publications