Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) snoRNA (ENSG00000207094.1) secondary structure diagram

Homo sapiens (human) snoRNA (ENSG00000207094.1) URS000004F833_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA67: SNORA67 is a small nucleolar RNA (snoRNA) belonging to the H/ACA class of snoRNAs [PMC6054847]. In a study using an in vitro model, SNORA67 was found to be differentially expressed between DKK3 transfected cells and PC3 empty vector [PMC9947504]. In MCF10A cells, DKC1 overexpression led to a significant increase in the levels of SNORA67 [PMC7760958]. SNORA67 targets U1445 on 18S rRNA [PMC7760958]. In MDA-MB-231 cells, DKC1 mRNA depletion led to a reduction of SNORA67 [PMC7760958]. The expression of SNORA67 is upregulated by DKC1 overexpression [PMC9005336]. Elevated expression of DKC1 is associated with upregulated expression of SNORA67 and increased U1445 modification on 18S ribosomal RNA in a breast cancer cell line [PMC9198423].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCCAAGGCGAUUCCCUCUCCAAGGGGACAUCUAGUGCCCCUCUCAGGAAAGUAGCAACUUGGAAUAGAAUCUGGCAUGCCUAAGGUCUUUGAGGAACAGGGAUGCUUAUUUCCUCUGCCUUCCUUGGCUGCCUACAUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications