Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-5100 URS0000044E25_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-5100: Mmu-mir-5100 is a type of microRNA that has been identified in mouse B cells and is located on chromosome 11 [PMC4488125]. It is one of the highly expressed miRNAs and has been found to be upregulated in certain groups [PMC5595893]. Although the expression of mmu-mir-5100 did not change, it has been associated with the downregulation of certain genes in neutrophils during pneumonia [PMC5595893]. Mmu-mir-5100 has also been detected to be differentially expressed in various studies, showing both upregulation and downregulation [PMC9001960] [PMC4079956] [PMC5148024] [PMC7945321]. Furthermore, mmu-mir-5100 has been found to be one of the miRNAs that are upregulated in exosomes after LPS treatment [PMC7945321]. Overall, mmu-mir-5100 appears to play a role in gene regulation and may have implications in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGAAUCCCAGCGGUGCCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications