Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-378f URS0000043B1D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-378f: Hsa-mir-378f is a microRNA that has been studied in various contexts [PMC9180980]. It was identified as one of the miRNAs in a study along with hsa-miR-885-5p, hsa-miR-200c-3p, and hsa-miR-4666a-3p [PMC9180980]. This study also found that hsa-mir-378f had 34 predicted target genes [PMC9180980]. Another study identified IGF1R as one of the target genes of hsa-mir-378f among the GMI signature, and the expression of hsa-mir-378f was significantly downregulated compared to the control group [PMC6595612]. In a different study, it was found that hsa-mir-378f and hsa-miR-6849-5p were downregulated in retinal tissue of DR patients, and bioinformatics analyses were used to predict lncRNAs that interact with these miRNAs [PMC9523404]. Hsa-mir-378f was also found to be significantly downregulated in stromal cells and identified as one of the dysregulated wb-miRNAs in other studies [PMC7583725] [PMC7880712]. These studies highlight the involvement and potential regulatory role of hsa-mir-378f in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGGACUUGGAGCCAGAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications