Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-20a-3p URS0000042E1F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-20a: Hsa-mir-20a is a microRNA that belongs to the hsa-mir-17 cluster and has been found to exhibit inconsistent expression patterns [PMC4665306]. In the ISK cell line, hsa-mir-20a and hsa-mir-18a were upregulated, while hsa-mir-19a and hsa-mir-92a were downregulated [PMC4665306]. The expression levels of several microRNAs and mRNAs were found to be associated with survival time. High expression of 7 DEmiRNAs, including hsa-mir-20a, was associated with prolonged survival time, while high expression levels of 11 other DEmiRNAs were related to poor prognosis [PMC7324900]. Primers used for qRT-PCR analysis of miR-20a included the sequence UAAAGUGCUUAUAGUGCAGGUAG [PMC6413564]. Hsa-miR-20a was identified as one of the most highly expressed miRNAs along with other miRNAs such as hsa-miR-126, hsa-miR-19a, and hsa-miR-21 [PMC6170608]. Overexpression of hsa-mir-20a has been shown to promote angiogenesis, cell invasion, and cell growth [PMC9221847]. Additionally, another microRNA called hsa-miR21 has been found to play a key role in invasiveness as well as radiosensitivity and/or chemosensitivity [PMC9221847].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGCAUUAUGAGCACUUAAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications