Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus let-7c stem-loop (gga-let-7c) URS0000031E12_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-let-7c: Gga-let-7c is a microRNA (miRNA) that is dominantly expressed in chicken breast muscle libraries [PMC3700833]. It has 26 different isoforms, making it one of the most highly expressed miRNAs [PMC4519947]. Some of the isoforms of gga-let-7c are identical to the reference in miRBase [PMC4519947]. The let-7 family, including gga-let-7c, is abundantly expressed in chicken breast muscle libraries and is among the top 20 most abundant miRNAs [PMC4519947]. In other studies, differentially expressed miRNAs were found in various contexts such as chicken lungs infected with avian influenza virus, A549 cells infected with influenza A virus, mice infected with recombinant influenza A H1N1 virus strains, cynomolgus macaques infected with highly pathogenic H5N1 avian virus, and chicken lung and trachea infected with avian influenza virus [PMC5389138]. In the ovary compared to the testis, gga-let-7a, gga-let-7f and gga-let-7c were down-regulated while gga-miR26a, gga-miR148a and gga-miR451 were up-regulated [PMC3526641].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

Publications