Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Hsa-Mir-154-P18_3p (mature (guide)) URS0000031935_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-154: Hsa-mir-154 is a microRNA that has been found to be positively correlated with longer survival time in a survival analysis study [PMC8321750]. It has also been observed to be depleted in mammary cancer cell lines [PMC4682251]. The downregulation of hsa-mir-154 has been shown to result in the downregulation of hsa-miR-494, hsa-miR-186, hsa-miR-100, and hsa-mir-154 [PMC8523229]. Hsa-mir-154 is part of the human C14MC and its equine orthologous miRNA has not been reported in the miRBase database [PMC6302407]. It has also been found to be differentially expressed in papillary thyroid carcinoma, where it is downregulated [PMC8510868]. Hsa-mir-154 has been identified as one of the key post-transcriptional regulatory factors for cHubGs (central hub genes) based on database analysis [PMC10031699]. Additionally, it has been shown to be differentially expressed in PC3 cells and is involved in arm switching, which may have functional consequences [PMC6874298] [PMC3531161]. Furthermore, hsa-mir-154 along with hsa-miR-145 and hsa-miR-93 have been found to be differentially expressed across tissue types and exhibit over-expression in triple-negative breast cancer (TNBC) compared to non-TNBC and normal-like tissue [PMC7139587].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAAACAUACACGGGAAACCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

Publications