Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1269a URS0000026A1D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

Hsa-Mir-1269: Hsa-mir-1269 is a miRNA that has been studied in various contexts. It has been constructed using chemosynthetic oligonucleotides and inserted into a plasmid [PMC6873743]. In a study on prognostic factors, hsa-mir-1269 was identified as one of the miRNAs associated with overall survival in patients with EC [PMC9200351]. It was also found to be potentially associated with alcohol-related EC [PMC9200351]. In another study, hsa-mir-1269 was assessed along with other miRNAs using the miRNA PCR Array, and its serum levels were measured [PMC5467072]. Furthermore, hsa-mir-1269 was found to be significantly involved in hepatocellular carcinoma (HCC) [PMC7467934]. Additionally, hsa-mir-1269 was identified as one of the differentially expressed miRNAs in a study using TCGA data [PMC5950030]. Finally, hsa-mir-1269 was found to have anti-correlated mRNA levels for several genes in a specific grouping [PMC4175465].

hsa-mir-1269a: Hsa-mir-1269a is a microRNA that has been implicated in various biological processes and diseases [PMC5952075]. In the context of ectopic pregnancy, a study using COX regression analysis found that abnormal expression levels of hsa-mir-1247 and hsa-mir-1269a, as well as salpingitis, may be risk factors [PMC5952075]. While the functional roles of the other three microRNAs in clear cell renal cell carcinoma (ccRCC) are still less reported to date, some other studies have revealed that hsa-mir-1269a could function as an onco-miRNA in non-small cell lung cancer (NSCLC) by down-regulating its target gene SOX6 [PMC6895828].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGGACUGAGCCGUGCUACUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications