v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 161 (LINC00161) URS0000017EC0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00161: LINC00161 is a long non-coding RNA (lncRNA) that has been found to be significantly upregulated in hepatocellular carcinoma (HCC) tissues [PMC6072812]. Its expression level has been identified as an independent prognostic factor for overall survival in HCC patients [PMC6072812]. Furthermore, it has been shown that the upregulated LINC00161 in HCC serum is derived from exosomes [PMC6072812]. LINC00161 has also been implicated in sensitizing osteosarcoma cells to cisplatin through its interaction with miR-645 [PMC6361746]. Additionally, another lncRNA, AC023115.3, acts as a competing endogenous RNA (ceRNA) for miR-26a to inhibit cisplatin resistance in glioma cells [PMC6361746]. In summary, LINC00161 is an upregulated lncRNA in HCC tissues and serum. Its expression level serves as an independent prognostic factor for overall survival in HCC patients. Furthermore, it plays a role in sensitizing osteosarcoma cells to cisplatin through its interaction with miR-645. Additionally, another lncRNA, AC023115.3, acts as a ceRNA for miR-26a to inhibit cisplatin resistance in glioma cells. References: 1. PMC6072812 2. PMC6361746

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAAUAACAUCUACCAAACAGUUUACAUUGUGCUAAACAACUUAUGCACAUUAUUUCUUUGAUUCUUUUUAACACAUGGUUGUGGGCUGAAUGGUGUCUCCCAAGAAGUCAUAUGCCGGGAUCCUGUCCCAUAGUGCCUCACAACGUGACAUUGUUUGGAGUUAGGGUUGUUGAAGAUGUCAUUAGUCAAGAUGAGGUCAUACUUGAGUGAGGUGGGUUUCUAAUCCAAUGUGACUGGUGUCUGUGAAAAGGGGAAAUGUGGACACAGGUCCACAUAUAAGGAGAACACCAUGUGAAGAUGAAGGUAGAAAUUACAGUGAUGUGUCUACAAGCCAAGGAACACCAAAGAUUGACAGAAAAUCACCAGAAGCCUAGAGAGGCAUGAAACAUUCUCCCUCAGAGCCUUCAGAAGAAAGCAAUCCUGCUGGCACCUUCAUCUUGGACUUUGAGCCUCUAGAACUGUGAGGCAAUACAUUUCUGUUGUUUAAGCCACCCAGUUUGUGGCAUUUUGUUACAGCAGCACUGGAAUCCUAAUGGAUGCUGUAUUAGAUAAAUAUUUUAGGCUUAGGAAGAAGAGAACUGUAGACAUGCAGCAGCCAUCUUGUGGAUAUGAGGGAAGAGCCAAAUAGACUACAAAUCGGUUAACACAGAGAACUAAAAUUGUGGAGCUACUGAAUGAACCAGCUAUGGAAUUGUCUGUGUGUGGGCAUUCAGAUGGACAUACCGGAUAAAAUUCUGGACUGGUAAGAGUGUGGGGAAAUUGCCAGUCUUAAGCAGUGCUGAUGGAGGUGUGAAUUGGUAAAACAAUUUGAAAAGUAAGUUGCUAGUUUUUAUAAAAUUUUUAAAAAUAAAUGUAUUCUCUGACCCAGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications