Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 50A (SNORA50A) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 50A (SNORA50A) URS0000013F57_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA50A: SNORA50A is a small nucleolar RNA, H/ACA Box 50A, with an unknown function [PMC6232700]. It has been found that the co-occurrence of IQGAP2 genomic alterations and the deletion in SNORA50A, SNORA50C, and RN7SK genes is associated with reduced disease-free survival in prostate cancer patients [PMC7336766]. A study by Xie et al. (2019) revealed that SNORA50A inhibits mRNA 3' processing by blocking the Fib1-poly(A) site interaction, which is the first report of snoRNA regulating mRNA 3' processing [PMC6629867]. In a study selecting twenty genes associated with prostate cancer progression, SNORA50A was among the genes identified [PMC8606581]. Interestingly, there were no SPOP mutations and copy number variations (CNV) for SNORA50A, SNORA50C, and RN7SK in a specific cohort of prostate cancer patients [PMC6232700]. The co-occurrence of CNV for SNORA50A, SNORA50C, and RN7SK with IQGAP2 genomic alterations suggests that noncoding RNAs may coordinate with IQGAP2 to suppress prostate cancer progression [PMC6232700]. Furthermore, these observed co-changes in IQGAP2 and snoRNA genes may have potential as a diagnostic tool for prostate cancer recurrence [PMC6232700]. Overall, while the function of SNORA50A remains unknown at present (PubMed), its involvement in genomic alterations associated with disease progression highlights its potential significance in prostate cancer research.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCACUGCCUUUGAACCUGAUGUGUCUUGUUUGUAGCUUCACGGGCCAAGCAACAGUGCUAGAGCAUAACGACUUGUUAUAACUGGGGCUCUUCAGCUCUCAACUGAACUGCUCUUUUAAAAACAAGGUACAUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Aotus nancymaae snoRNA (ENSANAG00000007617.1)
  2. Carlito syrichta snoRNA (ENSTSYG00000031917.1)
  3. Cebus imitator small nucleolar RNA, H/ACA box 50A (ENSCCAG00000004735.1)
  4. Cercocebus atys snoRNA (ENSCATG00000020581.1)
  5. Chlorocebus sabaeus small nucleolar RNA, H/ACA box 50A (ENSCSAG00000024117.1)
  6. Colobus angolensis palliatus (Angola colobus) snoRNA (ENSCANG00000001493.1)
  7. Gorilla gorilla gorilla small nucleolar RNA, H/ACA box 50A (ENSGGOG00000044047.1)
  8. Macaca fascicularis (Crab-eating macaque) small nucleolar RNA, H/ACA box 50A (ENSMFAG00000017889.2)
  9. Macaca mulatta small nucleolar RNA, H/ACA box 50A (ENSMMUG00000025577.3)
  10. Macaca nemestrina snoRNA (ENSMNEG00000014632.1)
  11. Mandrillus leucophaeus (Drill) snoRNA (ENSMLEG00000006078.1)
  12. Microcebus murinus small nucleolar RNA, H/ACA box 50A (ENSMICG00000047422.1)
  13. Nomascus leucogenys small nucleolar RNA, H/ACA box 50A (ENSNLEG00000035265.1)
  14. Pan paniscus small nucleolar RNA, H/ACA box 50A (ENSPPAG00000011379.1)
  15. Pan troglodytes small nucleolar RNA, H/ACA box 50A (ENSPTRG00000025867.3)
  16. Papio anubis snoRNA (ENSPANG00000038112.1)
  17. Piliocolobus tephrosceles small nucleolar RNA, H/ACA box 50A (ENSPTEG00000027234.1)
  18. Pongo abelii (Sumatran orangutan) snoRNA (ENSPPYG00000032028.1)
  19. Propithecus coquereli (Coquerel's sifaka) snoRNA (ENSPCOG00000011631.1)
  20. Rhinopithecus bieti snoRNA (ENSRBIG00000007277.1)
  21. Rhinopithecus roxellana (Golden snub-nosed monkey) small nucleolar RNA, H/ACA box 50A (ENSRROG00000008176.1)
  22. Theropithecus gelada small nucleolar RNA SNORA50 (ENSTGEG00000002961.1)
2D structure Publications