Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-520f-3p URS000000E601_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-520f: Hsa-mir-520f is a down-regulated miRNA that is part of a network of miRNAs, which includes 9 hub miRNAs, including 6 up-regulated miRNAs (hsa-miR-15b, hsa-miR-130a, hsa-miR-142-5p, hsa-miR-1246, hsa-miR-675, and hsa-miR-143) and 3 down-regulated miRNAs (hsa-mir-520f, hsa-miR-588, and hsa-miR-383) [1]. However, the expression trends of hsa-mir-520f were not consistent with the GEO data [2]. Hsa-mir-520f does not have any hub genes that can be used as target genes [2]. In PC3 cells, there are 7 differentially expressed miRNAs, including hsa-mir-433-3p, hsa-mir-154, hsa-mir-324 5p, hsa-miR-509-pre, hsa-mir-377, hsa-mir-520f, and hsa-mir-384 [3]. Additionally, it has been found that hsa-miR-125b-2, hsa-mir-520f, hsa-miR-3175, and hsa-miR-4672 can regulate the expression of target genes associated with immune and angiogenesis processes [4]. In hepatocellular carcinoma (HCC) tissues, there are 5 up-regulated miRNAs (hsa-miR-106b, hsa-miR-25, hsa-miR-93, hsa-miR-222, hsa-miR-221) and 5 down-regulated miRNAs (hsa-miR-424, hsa-mir-520f, hsa-miR-29c, hsa-miR-101, hsa-miR-422a) [5]. In a high-risk group, hsa-mir-520f is overexpressed [6]. References: [1] PMC5041942 [2] PMC8612537 [3] PMC6874298 [4] PMC8779150 [5] PMC6171011 [6] PMC5040965

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGUGCUUCCUUUUAGAGGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Gorilla gorilla gorilla ggo-miR-519b (MIR519B)
  2. Gorilla gorilla (western gorilla) ggo-miR-519b
  3. Pan troglodytes ptr-miR-520f
  4. Pongo pygmaeus ppy-miR-520f
Publications