v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-let-7e-5p URS000000B1C9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-let-7e: Hsa-let-7e (MIMAT0000066) is one of the primers used in the study [PMC3821025]. The study found that DIM, a compound, can inhibit the expression of EZH2 in castration-resistant prostate cancer [PMC6222788]. This inhibition is achieved by up-regulating hsa-let-7e, which is ranked at 13th among the primers used [PMC6222788]. The up-regulation of hsa-let-7e by DIM leads to a decrease in EZH2 expression [PMC6222788]. This finding suggests that hsa-let-7e may play a role in regulating EZH2 expression in castration-resistant prostate cancer [PMC6222788]. Further research is needed to fully understand the mechanism by which hsa-let-7e regulates EZH2 and its potential therapeutic implications for castration-resistant prostate cancer [PMC6222788].

mRNA interactions 6 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGGUAGGAGGUUGUAUAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Bos taurus Bta-Let-7-P1b_5p (mature (guide))
  2. Callithrix jacchus cja-let-7e
  3. Canis lupus familiaris (dog) cfa-let-7e
  4. Capra hircus (goat) chi-let-7e-5p
  5. Cavia porcellus cpo-let-7e-5p
  6. Cervus elaphus cel-let-7e
  7. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P1b_5p (mature (guide))
  8. Equus caballus eca-let-7e
  9. Macaca mulatta mml-let-7e-5p
  10. Mus musculus (house mouse) mmu-let-7e-5p
  11. Nomascus leucogenys nle-let-7e
  12. Oryctolagus cuniculus (rabbit) Ocu-Let-7-P1b_5p (mature (guide))
  13. Otolemur garnettii (small-eared galago) oga-let-7e
  14. Pan paniscus ppa-let-7e
  15. Pan troglodytes ptr-let-7e
  16. Papio hamadryas (hamadryas baboon) pha-let-7e
  17. Pongo pygmaeus (Bornean orangutan) ppy-let-7e
  18. Pteropus alecto pal-let-7e-5p
  19. Rattus norvegicus rno-let-7e-5p
  20. Saimiri boliviensis boliviensis sbo-let-7e
  21. Sus scrofa (pig) ssc-let-7e
  22. Tupaia chinensis tch-let-7e-5p
 Publications